cDNA Clone MELK (mouse)

• Synonyms: AI327312, MPK38, mKIAA0175
• Plasmid: pX335 mMELK ex2 KO antisense
• Parent Plasmid: pX335
• Expressed: mMELK ex2 KO antisense guide + Cas9 D10A
• Genbank: ENSMUSG00000035683
• Species: Mouse

Sequence of Insert

GATAATCTTTCATAGTCCACC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52387
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 2, use in conjunction with 52376.