cDNA Clone MEF2A (mouse)

• Synonyms: A430079H05Rik
• Plasmid: pBABED P U6 mMEF2A ex6 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: mMEF2A ex6 KO sense guide
• Genbank: ENSMUSG00000030557
• Species: Mouse

Sequence of Insert

GTTAGTGTACGACAAAGCATT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54165
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 6, use in conjunction with 54169.