cDNA Clone MEF2A (mouse)

• Synonyms: A430079H05Rik
• Plasmid: pX335 mMEF2A ex6 KO antisense
• Parent Plasmid: pX335
• Expressed: mMEF2A ex6 KO antisense guide + Cas9n
• Genbank: ENSMUSG00000030557
• Species: Mouse

Sequence of Insert

GTTCACTCGTGTCACCGTCTT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54169
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 6, use in conjunction with 54165.