cDNA Clone MEF2C (mouse)

• Synonyms: C80750
• Plasmid: pX335 mMEF2D ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: mMEF2D ex3 KO antisense guide + cas9n
• Genbank: ENSMUSG00000001419
• Species: Mouse

Sequence of Insert

GTGCCAGCACCGACATGGACA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54172
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with .