cDNA Clone MEF2D (mouse)

• Synonyms: C80750
• Plasmid: pBABED P U6 mMEF2D ex3 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: mMEF2D ex3 KO sense guide
• Genbank: ENSMUSG00000001419
• Species: Mouse

Sequence of Insert

GACTGGAACAGCTTGTTGGAG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54174
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 6, use in conjunction with .