cDNA Clone SP1 (mouse)

• Plasmid: pX335 mSP1 ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: mSP1 ex3 KO antisense guide + Cas9n
• Genbank: ENSMUSG00000001280
• Species: Mouse

Sequence of Insert

GCAAGGAAGTCAGCAGAAAGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54178
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 54176.