cDNA Clone - MERS Coronavirus S protein

Name: MERS Coronavirus S protein
Price per aliquot: £110.00
Expressed:
GST 3C MERS CoV S protein
Plasmid:
pGEX6P1 MERS CoV S protein (Custom)
Parent Plasmid:
pGEX6P1
View Parent Plasmid

Snapgene File | Genbank File
ACGTTATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCCCGGAATTCCCGGGTCGACTCGAGCGGCCGCATCGTGACTGACTGACGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATAAATTCCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTGGAATT
DU Number:
DU67745
Genbank:
Species:
MERS-CoV
Sequence of Insert:
View Sequence

GGATCCATGATTCATAGCGTGTTTCTGCTGATGTTTCTGCTGACCCCGACCGAAAGCTATGTGGATGTGGGCCCGGATAGCGTGAAAAGCGCGTGCATTGAAGTGGATATTCAGCAGACCTTTTTTGATAAAACCTGGCCGCGCCCGATTGATGTGAGCAAAGCGGATGGCATTATTTATCCGCAGGGCCGCACCTATAGCAACATTACCATTACCTATCAGGGCCTGTTTCCGTATCAGGGCGATCATGGCGATATGTATGTGTATAGCGCGGGCCATGCGACCGGCACCACCCCGCAGAAACTGTTTGTGGCGAACTATAGCCAGGATGTGAAACAGTTTGCGAACGGCTTTGTGGTGCGCATTGGCGCGGCGGCGAACAGCACCGGCACCGTGATTATTAGCCCGAGCACCAGCGCGACCATTCGCAAAATTTATCCGGCGTTTATGCTGGGCAGCAGCGTGGGCAACTTTAGCGATGGCAAAATGGGCCGCTTTTTTAACCATACCCTGGTGCTGCTGCCGGATGGCTGCGGCACCCTGCTGCGCGCGTTTTATTGCATTCTGGAACCGCGCAGCGGCAACCATTGCCCGGCGGGCAACAGCTATACCAGCTTTGCGACCTATCATACCCCGGCGACCGATTGCAGCGATGGCAACTATAACCGCAACGCGAGCCTGAACAGCTTTAAAGAATATTTTAACCTGCGCAACTGCACCTTTATGTATACCTATAACATTACCGAAGATGAAATTCTGGAATGGTTTGGCATTACCCAGACCGCGCAGGGCGTGCATCTGTTTAGCAGCCGCTATGTGGATCTGTATGGCGGCAACATGTTTCAGTTTGCGACCCTGCCGGTGTATGATACCATTAAATATTATAGCATTATTCCGCATAGCATTCGCAGCATTCAGAGCGATCGCAAAGCGTGGGCGGCGTTTTATGTGTATAAACTGCAGCCGCTGACCTTTCTGCTGGATTTTAGCGTGGATGGCTATATTCGCCGCGCGATTGATTGCGGCTTTAACGATCTGAGCCAGCTGCATTGCAGCTATGAAAGCTTTGATGTGGAAAGCGGCGTGTATAGCGTGAGCAGCTTTGAAGCGAAACCGAGCGGCAGCGTGGTGGAACAGGCGGAAGGCGTGGAATGCGATTTTAGCCCGCTGCTGAGCGGCACCCCGCCGCAGGTGTATAACTTTAAACGCCTGGTGTTTACCAACTGCAACTATAACCTGACCAAACTGCTGAGCCTGTTTAGCGTGAACGATTTTACCTGCAGCCAGATTAGCCCGGCGGCGATTGCGAGCAACTGCTATAGCAGCCTGATTCTGGATTATTTTAGCTATCCGCTGAGCATGAAAAGCGATCTGAGCGTGAGCAGCGCGGGCCCGATTAGCCAGTTTAACTATAAACAGAGCTTTAGCAACCCGACCTGCCTGATTCTGGCGACCGTGCCGCATAACCTGACCACCATTACCAAACCGCTGAAATATAGCTATATTAACAAATGCAGCCGCCTGCTGAGCGATGATCGCACCGAAGTGCCGCAGCTGGTGAACGCGAACCAGTATAGCCCGTGCGTGAGCATTGTGCCGAGCACCGTGTGGGAAGATGGCGATTATTATCGCAAACAGCTGAGCCCGCTGGAAGGCGGCGGCTGGCTGGTGGCGAGCGGCAGCACCGTGGCGATGACCGAACAGCTGCAGATGGGCTTTGGCATTACCGTGCAGTATGGCACCGATACCAACAGCGTGTGCCCGAAACTGGAATTTGCGAACGATACCAAAATTGCGAGCCAGCTGGGCAACTGCGTGGAATATAGCCTGTATGGCGTGAGCGGtagaGGCGTGTTTCAGAACTGCACCGCGGTGGGCGTGCGCCAGCAGCGCTTTGTGTATGATGCGTATCAGAACCTGGTGGGCTATTATAGCGATGATGGCAACTATTATTGCCTGCGCGCGTGCGTGAGCGTGCCGGTGAGCGTGATTTATGATAAAGAAACCAAAACCCATGCGACCCTGTTTGGCAGCGTGGCGTGCGAACATATTAGCAGCACCATGAGCCAGTATAGCCGCAGCACCCGCAGCATGCTGAAACGCCGCGATAGCACCTATGGCCCGCTGCAGACCCCGGTGGGCTGCGTGCTGGGCCTGGTGAACAGCAGCCTGTTTGTGGAAGATTGCAAACTGCCGCTGGGCCAGAGCCTGTGCGCGCTGCCGGATACCCCGAGCACCCTGACCCCGCGCAGCGTGCGCAGCGTGCCGGGCGAAATGCGCCTGGCGAGCATTGCGTTTAACCATCCGATTCAGGTGGATCAGCTGAACAGCAGCTATTTTAAACTGAGCATTCCGACCAACTTTAGCTTTGGCGTGACCCAGGAATATATTCAGACCACCATTCAGAAAGTGACCGTGGATTGCAAACAGTATGTGTGCAACGGCTTTCAGAAATGCGAACAGCTGCTGCGCGAATATGGCCAGTTTTGCAGCAAAATTAACCAGGCGCTGCATGGCGCGAACCTGCGCCAGGATGATAGCGTGCGCAACCTGTTTGCGAGCGTGAAAAGCAGCCAGAGCAGCCCGATTATTCCGGGCTTTGGCGGCGATTTTAACCTGACCCTGCTGGAACCGGTGAGCATTAGCACCGGCAGCCGCAGCGCGCGCAGCGCGATTGAAGATCTGCTGTTTGATAAAGTGACCATTGCGGAcCCGGGCTATATGCAGGGCTATGATGATTGCATGCAGCAGGGCCCGGCGAGCGCGCGCGATCTGATTTGCGCGCAGTATGTGGCGGGCTATAAAGTGCTGCCGCCGCTGATGGATGTGAACATGGAAGCGGCGTATACCAGCAGCCTGCTGGGCAGCATTGCGGGCGTGGGCTGGACCGCGGGCCTGAGCAGCTTTGCGGCGATTCCGTTTGCGCAGAGCATTTTTTATCGCCTGAACGGCGTGGGCATTACCCAGCAGGTGCTGAGCGAAAACCAGAAACTGATTGCGAACAAATTTAACCAGGCGCTGGGCGCGATGCAGACCGGCTTTACCACCACCAACGAAGCGTTTCGCAAAGTGCAGGATGCGGTGAACAACAACGCGCAGGCGCTGAGCAAACTGGCGAGCGAACTGAGCAACACCTTTGGCGCGATTAGCGCGAGCATTGGCGATATTATTCAGCGCCTGGATGTGCTGGAACAGGATGCGCAGATTGATCGCCTGATTAACGGCCGCCTGACCACCCTGAACGCGTTTGTGGCGCAGCAGCTGGTGCGCAGCGAAAGCGCGGCGCTGAGCGCGCAGCTGGCGAAAGATAAAGTGAACGAATGCGTGAAAGCGCAGAGCAAACGCAGCGGCTTTTGCGGCCAGGGCACCCATATTGTGAGCTTTGTGGTGAACGCGCCGAACGGCCTGTATTTTATGCATGTGGGCTATTATCCGAGCAACCATATTGAAGTGGTGAGCGCGTATGGCCTGTGCGATGCGGCGAACCCGACCAACTGCATTGCGCCGGTGAACGGCTATTTTATTAAAACCAACAACACCCGCATTGTGGATGAATGGAGCTATACCGGCAGCAGCTTTTATGCGCCGGAACCGATTACCAGCCTGAACACCAAATATGTGGCGCCGCAGGTGACCTATCAGAACATTAGCACCAACCTGCCGCCGCCGCTGCTGGGCAACAGCACCGGCATTGATTTTCAGGATGAACTGGATGAATTTTTTAAAAACGTGAGCACCAGCATTCCGAACTTTGGCAGCCTGACCCAGATTAACACCACCCTGCTGGATCTGACCTATGAAATGCTGAGCCTGCAGCAGGTGGTGAAAGCGCTGAACGAAAGCTATATTGATCTGAAAGAACTGGGCAACTATACCTATTATAACAAATGGCCGTGGTATATTTGGCTGGGCTTTATTGCGGGCCTGGTGGCGCTGGCGCTGTGCGTGTTTTTTATTCTGTGCTGCACCGGCTGCGGCACCAACTGCATGGGCAAACTGAAATGCAACCGCTGCTGCGATCGCTATGAAGAATATGATCTGGAACCGCATAAAGTGCATGTGCATtgaGCGGCCGC
Amino Acid Sequence:
View Sequence

MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGSMIHSVFLLMFLLTPTESYVDVGPDSVKSACIEVDIQQTFFDKTWPRPIDVSKADGIIYPQGRTYSNITITYQGLFPYQGDHGDMYVYSAGHATGTTPQKLFVANYSQDVKQFANGFVVRIGAAANSTGTVIISPSTSATIRKIYPAFMLGSSVGNFSDGKMGRFFNHTLVLLPDGCGTLLRAFYCILEPRSGNHCPAGNSYTSFATYHTPATDCSDGNYNRNASLNSFKEYFNLRNCTFMYTYNITEDEILEWFGITQTAQGVHLFSSRYVDLYGGNMFQFATLPVYDTIKYYSIIPHSIRSIQSDRKAWAAFYVYKLQPLTFLLDFSVDGYIRRAIDCGFNDLSQLHCSYESFDVESGVYSVSSFEAKPSGSVVEQAEGVECDFSPLLSGTPPQVYNFKRLVFTNCNYNLTKLLSLFSVNDFTCSQISPAAIASNCYSSLILDYFSYPLSMKSDLSVSSAGPISQFNYKQSFSNPTCLILATVPHNLTTITKPLKYSYINKCSRLLSDDRTEVPQLVNANQYSPCVSIVPSTVWEDGDYYRKQLSPLEGGGWLVASGSTVAMTEQLQMGFGITVQYGTDTNSVCPKLEFANDTKIASQLGNCVEYSLYGVSGRGVFQNCTAVGVRQQRFVYDAYQNLVGYYSDDGNYYCLRACVSVPVSVIYDKETKTHATLFGSVACEHISSTMSQYSRSTRSMLKRRDSTYGPLQTPVGCVLGLVNSSLFVEDCKLPLGQSLCALPDTPSTLTPRSVRSVPGEMRLASIAFNHPIQVDQLNSSYFKLSIPTNFSFGVTQEYIQTTIQKVTVDCKQYVCNGFQKCEQLLREYGQFCSKINQALHGANLRQDDSVRNLFASVKSSQSSPIIPGFGGDFNLTLLEPVSISTGSRSARSAIEDLLFDKVTIADPGYMQGYDDCMQQGPASARDLICAQYVAGYKVLPPLMDVNMEAAYTSSLLGSIAGVGWTAGLSSFAAIPFAQSIFYRLNGVGITQQVLSENQKLIANKFNQALGAMQTGFTTTNEAFRKVQDAVNNNAQALSKLASELSNTFGAISASIGDIIQRLDVLEQDAQIDRLINGRLTTLNAFVAQQLVRSESAALSAQLAKDKVNECVKAQSKRSGFCGQGTHIVSFVVNAPNGLYFMHVGYYPSNHIEVVSAYGLCDAANPTNCIAPVNGYFIKTNNTRIVDEWSYTGSSFYAPEPITSLNTKYVAPQVTYQNISTNLPPPLLGNSTGIDFQDELDEFFKNVSTSIPNFGSLTQINTTLLDLTYEMLSLQQVVKALNESYIDLKELGNYTYYNKWPWYIWLGFIAGLVALALCVFFILCCTGCGTNCMGKLKCNRCCDRYEEYDLEPHKVHVH*
Antibiotic:
Amp
Comments:
Codon optimised for bacterial expression.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.