cDNA Clone - Rab10

Name: Rab10
Price per aliquot: £110.00
Expressed:
6His-Thrombin-Rab10 M1-S181 Codon Opt
Plasmid:
pET28a 6HIS Thrombin Rab10 M1-S181 Codon OPT
Parent Plasmid:
pET28a
View Parent Plasmid

|
DU Number:
DU68199
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCCAAAAAAACCTATGACCTGCTGTTTAAACTGCTGCTGATTGGTGATAGCGGTGTTGGTAAAACCTGTGTTCTGTTTCGTTTTTCCGATGATGCATTTAACACCACCTTTATTAGCACCATCGGCATCGACTTTAAAATCAAAACCGTTGAACTGCAGGGCAAGAAAATCAAACTGCAGATTTGGGATACCGCAGGTCAAGAACGTTTTCATACCATTACCACCAGTTATTATCGTGGTGCAATGGGTATTATGCTGGTGTATGATATTACCAACGGCAAAAGCTTTGAGAACATTAGCAAATGGCTGCGCAACATTGATGAACATGCAAATGAAGATGTTGAACGTATGCTGCTGGGTAACAAATGTGATATGGATGATAAACGTGTTGTGCCGAAAGGTAAAGGTGAGCAGATTGCACGTGAACATGGTATTCGTTTTTTTGAAACCAGCGCCAAAGCCAACATCAACATTGAAAAAGCATTTCTGACCCTGGCCGAAGATATTCTGCGTAAAACACCGGTTAAAGAACCGAATAGCTAAGCGGCCGC
Amino Acid Sequence:
View Sequence

MGSSHHHHHHSSGLVPRGSHMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNS*
Antibiotic:
Kan
Low Growth Temperature Requirement?:
No

Do you need any help? Please get in touch and we’ll be happy to lend a hand.