cDNA Clone - RAB12

Name: RAB12
Price per aliquot: £110.00
Expressed:
RAB12 Nter KI G3 Single Vector + Cas9
Plasmid:
RAB12 Nter KI G3
View Parent Plasmid

DU Number:
DU64713
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GCCGCATGCGTGTATGGATCC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Low Growth Temperature Requirement?:
No
Comments:
CRISPR KI guide, single vector system expressing spCas9 and puro. Use in conjunction with a suitable donor.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.