cDNA Clone - Rab10

Name: Rab10
Price per aliquot: £110.00
Expressed:
HA-Rab10
Plasmid:
pUNO1 HA RAB10
Parent Plasmid:
pUNO1
View Parent Plasmid

|
DU Number:
DU62271
Species:
Human
Sequence of Insert:
View Sequence

GGATCCATGTACCCATACGATGTGCCAGATTACGCCGGATCTATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAGACCCCTGTAAAAGAGCCCAACAGTGAAAATGTAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGAAGAGCAAATGCTGCTGAGCTAGC
Amino Acid Sequence:
View Sequence

MYPYDVPDYAGSMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNSENVDISSGGGVTGWKSKCC*
Antibiotic:
Blasticidin
Low Growth Temperature Requirement?:
No

Do you need any help? Please get in touch and we’ll be happy to lend a hand.