cDNA Clone - ZUFSP

Name: ZUFSP
Price per aliquot: £110.00
Expressed:
MBP-C3-ZUFSP
Plasmid:
pMEX ZUFSP
Parent Plasmid:
pMEX
View Parent Plasmid

|
DU Number:
DU59309
Species:
Human
Synonyms:
C6orf113; dJ412I7.3; RP3-412I7.3
Sequence of Insert:
View Sequence

GGATCCATGCTTTCCTGTAATATTTGTGGTGAAACAGTAACCTCAGAACCAGACATGAAAGCTCACCTAATTGTTCACATGGAAAGTGAAATTATATGTCCATTTTGCAAGTTGTCAGGTGTGAATTATGATGAAATGTGTTTTCATATCGAAACAGCTCATTTTGAGCAGAATACACTTGAAAGAAACTTTGAGAGGATAAATACAGTACAATATGGAACTTCAGATAACAAGAAAGACAACACCCTACAGTGTGGAATGGAAGTTAATTCAAGTATTCTTTCAGGTTGTGCATCTAATCATCCAAAAAATTCAGCTCAAAACCTGACTAAAGATAGTACTTTAAAACATGAAGGCTTCTATTCAGAGAACTTAACTGAATCTAGAAAATTCCTGAAAAGTAGGGAAAAACAGTCCAGCCTGACCGAAATAAAAGGATCTGTTTATGAAACAACATACAGTCCTCCTGAATGTCCATTCTGTGGAAAAATAGAGGAGCACAGTGAAGATATGGAAACTCATGTGAAAACAAAGCATGCCAATCTTTTAGACATTCCATTGGAAGACTGTGATCAACCACTCTATGATTGTCCTATGTGTGGGCTCATATGTACAAATTACCATATTCTTCAGGAACATGTTGACTTGCATTTGGAAGAAAACAGCTTTCAGCAAGGCATGGATAGAGTCCAGTGTTCTGGTGATCTACAATTGGCTCACCAGCTTCAGCAAGAAGAAGACAGAAAGAGGAGATCTGAAGAATCAAGACAAGAAATAGAAGAATTTCAGAAGCTGCAGAGACAATATGGTTTAGATAATTCTGGAGGATACAAACAACAACAACTACGAAATATGGAGATAGAAGTAAATAGGGGAAGAATGCCTCCATCTGAATTTCATAGGAGAAAAGCTGATATGATGGAATCATTAGCTCTTGGTTTTGACGATGGAAAAACAAAAACTTCCGGAATTATTGAAGCACTTCATAGGTATTATCAGAATGCTGCCACAGATGTGAGACGGGTGTGGCTTTCTTCAGTGGTGGATCACTTTCATTCATCTTTAGGCGACAAAGGTTGGGGTTGTGGTTACAGAAATTTCCAAATGCTACTTTCATCATTATTACAAAATGATGCTTACAACGATTGCTTAAAAGGTATGTTGATTCCTTGCATTCCAAAAATTCAATCTATGATTGAAGATGCATGGAAGGAAGGTTTTGATCCTCAGGGGGCCTCTCAACTTAATAACAGGTTACAGGGAACAAAGGCCTGGATTGGAGCATGTGAAGTATATATACTCCTGACCTCCCTAAGGGTAAAGTGTCATATTGTTGATTTTCACAAATCAACTGGTCCTTTGGGTACACACCCTCGCTTATTTGAATGGATATTGAACTATTATTCTTCAGAGGGAGAAGGGAGTCCAAAGGTAGTGTGTACATCTAAACCTCCTATCTATCTTCAGCATCAAGGTCACAGTCGAACTGTTATTGGAATTGAAGAGAAAAAAAACCGAACATTATGCTTACTAATACTTGATCCTGGATGTCCTTCTCGAGAAATGCAGAAATTATTAAAGCAAGACATAGAGGCTAGCAGTCTCAAGCAACTTCGGAAATCTATGGGAAATTTAAAACATAAGCAATACCAGATATTGGCAGTAGAGGGTGCTCTTTCTCTAGAGGAGAAACTTGCCAGGAGACAAGCTTCTCAAGTCTTTACAGCCGAGAAGATTCCTTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELVKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGDDDDKVPEFLEVLFQGPLGSMLSCNICGETVTSEPDMKAHLIVHMESEIICPFCKLSGVNYDEMCFHIETAHFEQNTLERNFERINTVQYGTSDNKKDNTLQCGMEVNSSILSGCASNHPKNSAQNLTKDSTLKHEGFYSENLTESRKFLKSREKQSSLTEIKGSVYETTYSPPECPFCGKIEEHSEDMETHVKTKHANLLDIPLEDCDQPLYDCPMCGLICTNYHILQEHVDLHLEENSFQQGMDRVQCSGDLQLAHQLQQEEDRKRRSEESRQEIEEFQKLQRQYGLDNSGGYKQQQLRNMEIEVNRGRMPPSEFHRRKADMMESLALGFDDGKTKTSGIIEALHRYYQNAATDVRRVWLSSVVDHFHSSLGDKGWGCGYRNFQMLLSSLLQNDAYNDCLKGMLIPCIPKIQSMIEDAWKEGFDPQGASQLNNRLQGTKAWIGACEVYILLTSLRVKCHIVDFHKSTGPLGTHPRLFEWILNYYSSEGEGSPKVVCTSKPPIYLQHQGHSRTVIGIEEKKNRTLCLLILDPGCPSREMQKLLKQDIEASSLKQLRKSMGNLKHKQYQILAVEGALSLEEKLARRQASQVFTAEKIP*
Antibiotic:
Amp
Low Growth Temperature Requirement?:
No

Do you need any help? Please get in touch and we’ll be happy to lend a hand.