cDNA Clone - A20

Name: A20
Price per aliquot: £110.00
Expressed:
GFP-A20
Plasmid:
pcDNA FRT TO GFP A20
Parent Plasmid:
pcDNA FRT TO GFP
View Parent Plasmid

|
DU Number:
DU55909
Sequence of Insert:
View Sequence

GCGGCCGCGATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATGGCCCGAAGTGGACTTCAGTACAACTCACTGGAAGAAATACACATATTTGTCCTTTGCAACATCCTCAGAAGGCCAATCATTGTCATTTCAGACAAAATGCTAAGAAGTTTGGAATCAGGTTCCAATTTCGCCCCTTTGAAAGTGGGTGGAATTTACTTGCCTCTCCACTGGCCTGCCCAGGAATGCTACAGATACCCCATTGTTCTCGGCTATGACAGCCATCATTTTGTACCCTTGGTGACCCTGAAGGACAGTGGGCCTGAAATCCGAGCTGTTCCACTTGTTAACAGAGACCGGGGAAGATTTGAAGACTTAAAAGTTCACTTTTTGACAGATCCTGAAAATGAGATGAAGGAGAAGCTCTTAAAAGAGTACTTAATGGTGATAGAAATCCCCGTCCAAGGCTGGGACCATGGCACAACTCATCTCATCAATGCCGCAAAGTTGGATGAAGCTAACTTACCAAAAGAAATCAATCTGGTAGATGATTACTTTGAACTTGTTCAGCATGAGTACAAGAAATGGCAGGAAAACAGCGAGCAGGGGAGGAGAGAGGGGCACGCCCAGAATCCCATGGAACCTTCCGTGCCCCAGCTTTCTCTCATGGATGTAAAATGTGAAACGCCCAACTGCCCCTTCTTCATGTCTGTGAACACCCAGCCTTTATGCCATGAGTGCTCAGAGAGGCGGCAAAAGAATCAAAACAAACTCCCAAAGCTGAACTCCAAGCCGGGCCCTGAGGGGCTCCCTGGCATGGCGCTCGGGGCCTCTCGGGGAGAAGCCTATGAGCCCTTGGCGTGGAACCCTGAGGAGTCCACTGGGGGGCCTCATTCGGCCCCACCGACAGCACCCAGCCCTTTTCTGTTCAGTGAGACCACTGCCATGAAGTGCAGGAGCCCCGGCTGCCCCTTCACACTGAATGTGCAGCACAACGGATTTTGTGAACGTTGCCACAACGCCCGGCAACTTCACGCCAGCCACGCCCCAGACCACACAAGGCACTTGGATCCCGGGAAGTGCCAAGCCTGCCTCCAGGATGTTACCAGGACATTTAATGGGATCTGCAGTACTTGCTTCAAAAGGACTACAGCAGAGGCCTCCTCCAGCCTCAGCACCAGCCTCCCTCCTTCCTGTCACCAGCGTTCCAAGTCAGATCCCTCGCGGCTCGTCCGGAGCCCCTCCCCGCATTCTTGCCACAGAGCTGGAAACGACGCCCCTGCTGGCTGCCTGTCTCAAGCTGCACGGACTCCTGGGGACAGGACGGGGACGAGCAAGTGCAGAAAAGCCGGCTGCGTGTATTTTGGGACTCCAGAAAACAAGGGCTTTTGCACACTGTGTTTCATCGAGTACAGAGAAAACAAACATTTTGCTGCTGCCTCAGGGAAAGTCAGTCCCACAGCGTCCAGGTTCCAGAACACCATTCCGTGCCTGGGGAGGGAATGCGGCACCCTTGGAAGCACCATGTTTGAAGGATACTGCCAGAAGTGTTTCATTGAAGCTCAGAATCAGAGATTTCATGAGGCCAAAAGGACAGAAGAGCAACTGAGATCGAGCCAGCGCAGAGATGTGCCTCGAACCACACAAAGCACCTCAAGGCCCAAGTGCGCCCGGGCCTCCTGCAAGAACATCCTGGCCTGCCGCAGCGAGGAGCTCTGCATGGAGTGTCAGCATCCCAACCAGAGGATGGGCCCTGGGGCCCACCGGGGTGAGCCTGCCCCCGAAGACCCCCCCAAGCAGCGTTGCCGGGCCCCCGCCTGTGATCATTTTGGCAATGCCAAGTGCAACGGCTACTGCAACGAATGCTTTCAGTTCAAGCAGATGTATGGCTAAGCGGCCGC
Amino Acid Sequence:
View Sequence

MVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKSGLGSPGEFASLEKLAAAMAEQVLPQALYLSNMRKAVKIRERTPEDIFKPTNGIIHHFKTMHRYTLEMFRTCQFCPQFREIIHKALIDRNIQATLESQKKLNWCREVRKLVALKTNGDGNCLMHATSQYMWGVQDTDLVLRKALFSTLKETDTRNFKFRWQLESLKSQEFVETGLCYDTRNWNDEWDNLIKMASTDTPMARSGLQYNSLEEIHIFVLCNILRRPIIVISDKMLRSLESGSNFAPLKVGGIYLPLHWPAQECYRYPIVLGYDSHHFVPLVTLKDSGPEIRAVPLVNRDRGRFEDLKVHFLTDPENEMKEKLLKEYLMVIEIPVQGWDHGTTHLINAAKLDEANLPKEINLVDDYFELVQHEYKKWQENSEQGRREGHAQNPMEPSVPQLSLMDVKCETPNCPFFMSVNTQPLCHECSERRQKNQNKLPKLNSKPGPEGLPGMALGASRGEAYEPLAWNPEESTGGPHSAPPTAPSPFLFSETTAMKCRSPGCPFTLNVQHNGFCERCHNARQLHASHAPDHTRHLDPGKCQACLQDVTRTFNGICSTCFKRTTAEASSSLSTSLPPSCHQRSKSDPSRLVRSPSPHSCHRAGNDAPAGCLSQAARTPGDRTGTSKCRKAGCVYFGTPENKGFCTLCFIEYRENKHFAAASGKVSPTASRFQNTIPCLGRECGTLGSTMFEGYCQKCFIEAQNQRFHEAKRTEEQLRSSQRRDVPRTTQSTSRPKCARASCKNILACRSEELCMECQHPNQRMGPGAHRGEPAPEDPPKQRCRAPACDHFGNAKCNGYCNECFQFKQMYG*
Antibiotic:
Amp
Low Growth Temperature Requirement?:
No
Comments:
Please clone A20 with an N-terminal GFP tag into pcDNA5 FRT/TO hygro. Thank you.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.