cDNA Clone - ZUFSP

Name: ZUFSP
Price per aliquot: £110.00
Expressed:
ZUFSP shRNA nt665-685
Plasmid:
pSUPERIOR puro retro ZUFSP shRNA nt665-685
Parental Plasmid:
pSUPERIOR puro retro
View Parent Plasmid

|
DU Number:
DU55743
Sequence of Insert:
View Sequence

CCGGGCTTTCAGCAAGGCATGGATACTCGAGTATCCATGCCTTGCTGAAAGCTTTTTTG
Amino Acid Sequence:
View Sequence

Bacterial Selection:
Amp
Low Growth Temperature Requirement?:
No

Do you need any help? Please get in touch and we’ll be happy to lend a hand.