cDNA Clone - Rab12 (mouse)

Name: Rab12 (mouse)
Price per aliquot: £110.00
Plasmid:
pMK-RQ RAb12 (mouse)
Parent Plasmid:
pMK-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaaggaaggccgtcaaggccgcatccctgggcctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU51756
Species:
Mouse
Sequence of Insert:
View Sequence

GAATTCATGGATCCCAGCGCCGCGCTGCACCGGCGGCCCGCGGGCGGCAGCCTGGGCGCGGTCTCCCCGGCGCTGTCGGGCGGCCAGGCCCGCCGGAGGAAGCAGCCCCCCAGGCCGGCCGACTTCAAGCTGCAGGTCATCATCATCGGCTCCCGCGGCGTGGGCAAGACCAGCCTGATGGAGCGCTTCACCGACGACACGTTCTGCGAGGCCTGCAAGTCCACCGTGGGTGTTGACTTTAAAATCAAGACTGTAGAACTAAGAGGGAAGAAAATTAGATTACAGATCTGGGACACAGCAGGGCAGGAGCGATTTAACAGCATTACCTCAGCCTATTACAGAAGTGCCAAGGGGATCATACTCGTATATGACATCACCAAGAAGGAGACGTTCGATGACTTGCCAAAGTGGATGAAGATGATTGACAAGTATGCTTCAGAAGACGCCGAGCTCCTCCTGGTTGGAAATAAGCTGGACTGTGAGACAGACAGAGAAATCTCAAGGCAGCAAGGAGAAAAGTTTGCACAGCAGATAACCGGGATGCGCTTCTGCGAAGCCAGTGCCAAGGACAATTTCAATGTGGACGAGATCTTTCTGAAACTTGTTGATGATATTCTGAAAAAGATGCCTCTTGATGTTTTGAGAAACGAGTTATCCAATAGCATCCTTTCTCTACAACCAGAGCCTGAGATCCCACCAGAGCTGCCTCCTCCCAGACCACACGTCCGATGCTGTTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

Antibiotic:
Kan

Do you need any help? Please get in touch and we’ll be happy to lend a hand.