cDNA Clone - RAB8B

Name: RAB8B
Price per aliquot: £110.00
Expressed:
RAB8B ex3 KO antisense guide + Cas9 D10A
Plasmid:
pX335 RAB8B ex3 KO antisense
Parent Plasmid:
pX335
View Parent Plasmid

|
DU Number:
DU52778
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GAGTACGCTGTCGTGATTGTT
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR KO guide targeting exon 3, use in conjunction with 52764.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.