cDNA Clone - RAB8A

Name: RAB8A
Price per aliquot: £110.00
Expressed:
RAB8A Nter KI antisense guide + cas9 D10A
Plasmid:
pX335 RAB8A Nter KI antisense
Parent Plasmid:
pX335
View Parent Plasmid

|
DU Number:
DU52679
Genbank:
Species:
Human
Synonyms:
MEL, RAB8
Sequence of Insert:
View Sequence

GATATTACACTCTCTCCCCGA
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR Nter KI guide, use in conjunction with 52654 and a suitable donor.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.