cDNA Clone - RAB8A

Name: RAB8A
Price per aliquot: £110.00
Plasmid:
pMK-RQ RAB8A Nter HA donor
Parent Plasmid:
pMK-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaaggaaggccgtcaaggccgcatccctgggcctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU48993
Genbank:
Species:
Human
Synonyms:
MEL, RAB8
Sequence of Insert:
View Sequence

gcggccgcACACCCGCCCCAACTACTGGCGTGCGCCCTCTGCTGTCGCCTAACGGAACTCCGGGCGCGCGTGCGCACGCACCCCAAGCCACGCCCCGCCAGGCTGCCGGCGCGCGAGCGGTTGGCGCCGCTCCCTGCCTTCCCTCTCCTACAGTGGGGCGGGGCCGGGCCGCCCGAGTCGGGGGTGGAAGGCGGGGGCCACATAATGCCACGCCCCCGCCTCGTCCCCATTTGAAGCCCCGCGACTCTTCACTGCTGGTCAATCAGAGCCCGTGCTCTCCCTAGTGCCGGCCAATGGGAGGTGCGCTCGGGCTGCTTCCGGCTCCGCGCTCCGCTCGCCCCCTCCCAAGGTCTCCCCGCGACTGGCGGGACGCAGGGGCGGGCGTCGGCCGCGGTGACGCGCAGCGGGCCTGGAGCCAATAAGGGGCGGGCTCGGTGCTGATGGACGGTGCTGGTGGCCAGTGGAGAGGCGCTGGCCGCACTTCCCGTCGGGGAGAGAGTGTAATATGTACCCATACGATGTGCCAGATTACGCCGCGAAGACaTAtGATTACttaTTCAAGCTGCTGCTGATCGGGGACagtGGtGTaGGtAAGACCTGTGTCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACTTTTATCTCCACCATAGGTAACGGGACCGGGGAATGGCTGGGGGCGCCGGAGGCCCGGGCTGGGCGCGCCCCTGAGGGGCTGGGGCTGAGGGATCTACAGGGCTGGACGGGCCGAGGGCGCTGAGAGGGTCGAGGGGGCCTAAAGGGAGAAGAGCAGTCGCCTGCACCGCCGTTCGGGGGTTCCTGGGCCGTGGTGGGGGAGACCAGGTGCCCATTTTGCAGATAGGGAGACTGAGGCTCCGACCCTCAGCCCGCTCGTTAGGGCGTGTTATGTCTTGGGCTGGGGTCTTCGCGCCCGTCCTCTCGATCTGTCCTAGCAGCAGCCCTCGAAGCGGTTCTTTTGAGGCTCTTGCCTTACAGAAGTGGAAACTGAGTCATGGGGAATTGGCCATGGGAAAAAGACAGTGGCATCTCACCTTAATGAGCATTTACTATGTGCCAAGTGCTTCACGTgcggccgc
Amino Acid Sequence:
View Sequence

Antibiotic:
Kan
Comments:
CRISPR donor plasmid. Designed to KI an HA tag to the N-terminus of RAB8A when co-transfected with guides 48934 and 48948. Donor sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line, contains several silent mutations to prevent binding of guides.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.