cDNA Clone - RAB1B

Name: RAB1B
Price per aliquot: £110.00
Plasmid:
pMA RAB1B Nter HA donor
Parent Plasmid:
pMA
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattggcggaaggccgtcaaggcctaggcgcgccatgagctctaaagcttcgctcgagctgcggccgcacggatcctcgaattcccaagcttatctcgagtagcggccgcttggatcccagaattctaggtacctcttaattaactggcctcatgggccttccgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaaccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU48991
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

gcggccgcAGTTAGGACTGCCCAGTACACGAAGAACCCTGGACAAATGTACTTTTATTAGTCTTACTAGAACCCACATTCTCATTTAATGTTCACAACGTGGGTATTGGGAGGGCAAGGATGACTACCTCCGTCAGACAGATGTGAAACGTGCCAAGCCCAGCCCTAAATTGAGCTTTCTAAACACCGAGTCGCGGTCAGGCTTTCCAGCACTGTCCTCAAGCCTGAGTGCGTCCGGAGTGCAAACTACAAGCCCCAGAAGGCAATGCGCCAGCAGTGATGGGAGTGGGCGCGGAGGCGCGGGCTCCCCGACTACGCCTGCGCAGCGGGGCTGAGTTGGAGAACGTCTTAGACTACAAGTTCCGGGAATCAGCGCGGCGAGGCCTGAGAAGAAGACGTTTGCGCCTGCGCGTCGCGGGCGGGGCCTCTGGGGCGGAGCGGCCACCATCTTGGAACGGGAGGCGGAGCAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGTACCCATACGATGTGCCAGATTACGCCAACCCaGAgTAGTGAGTGAGCCCCGCCCGCGCCGTCCAGCGCAGCCTCGATCCCGAATACAttGCTGTACGCTTACCGGGGTTGTCTGGCCCGGGTCAGGACTGTGCGGCGCCCCCACATCCGGGTCCCTCTTCCGCTGACCCCCCCCCACATCCGGGTTCTGCCCCTCCCCCCAGGGGCCCCAGGACCCCGGCTCAAAACCCCGAGCCCTCGCACCCGGGGCCCAGACGTGGCGACCCCCAGGGGCAGCTCTTGGAGCTCGAGACATCGGTCCTACCAGGCCTTATCGGTCAGATGACCCCGCAGTCCCGGTCACTTCAGGCCTCAGTTTCCCCACCTGCTGCTTGACAACTGTCCCGGAGTTTTGGAGCCCGTCTTGATAGTTTCTGGTCTCGGGTTCAGGCTTGGGCCCTTTAGGTCGGGCAGTGAATCCCTCTACCCTTCTCTTTCTCCTGAAGCCCGGCTCCTGGGGCCGGCCCAGAAGCTAGCCAACTACGCGGGAGGCCCCGAAGCGCCGCTTGGGTCGCGTCTCCCGCAGGTCCTCTCTTCCGGGGCTGCCTCCTgcggccgc
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR donor plasmid. Designed to KI an HA tag to the N-terminus of RAB1B when co-transfected with guides 48938 and 48952. Donor sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line, contains several silent mutations to prevent binding of guides.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.