cDNA Clone - RAB1A

Name: RAB1A
Price per aliquot: £110.00
Plasmid:
pMK-RQ RAB1A Nter HA donor
Parent Plasmid:
pMK-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaaggaaggccgtcaaggccgcatccctgggcctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU48990
Genbank:
Species:
Human
Synonyms:
RAB1, YPT1
Sequence of Insert:
View Sequence

gcggCCGCCAGGGGGAGTCCGAGCGAAGTCCTAGCCAGCGAGTCAGAGGGGAGGGGAGCAGGGAGGGGCCGAGGGTGGGGAGGTGAGGGAGTGGGGAATGGGGCGGGCGACAACCCTTCAGGTACGCATGCCCCAGAGGCGCGGCGCTTGGCGGGAAGCTGAGTCCTGGCCTTGCGTCGCACTGTCTGTCCTCAGCTCGCGTAGCCGCGCTCGCGACTCCCTTTCCCGGCATGCCAGGCGGTGCGGCCGCCCTCTGGGCCGTGTAAAGGCCCCTCGGTCTAAGGCTTCCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCCTATCTCATTCCTTTCTTTCGATTACCCGTGGCGCGGAGAGTCAGGGCGGCGGCTGCGGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTACCCATACGATGTGCCAGATTACGCCagtAGCATGAATCCCGAATAGTGAGTTCAGGAGAGCACCaaTCGGCTGGGTCCGTGGGCCAGCTTGGGGGATCTTAAAGGGGTCGAGGAGGGTTGGGGCAGAAGTCGGGGCATCGGCTGGGGTGAGGCGAGGGTGATGGGTCAGGAGAGGCTGGCGGCCGGGAGTCGGGCCCCATTGTCTGACGCGGAGGGGCGGCCGCGCGGGGGAGGGGTCGGGCCGGAGGGGTGAGCCGCCCGGGCCTGGACCGGGTCAGGTTAGAGGGCCTGACTGCGGGGCGGGTGCTGAGGAAGCCTGCCGAGGGGCCTGGGGCGGTGTGAAGGGGTATCTTCTCTCGGAGGCAGTGACTTTTGAAGGAGGACTTGTCTCTAAGGGGAGGGGATGGGGTGGGAGAGCCCTTCTAGAGGGCACTGTCAGACCCTGCGCCCGCACTCTGCGGAGCTGTCAGGATCTTCGGGGTAGAAACCAGCTTTACTTGTAAATCCTGAGCTTGTTGGCTCTCTCTCCTTCCATCCTCCCCGCCAGGTTTCAGGTAATATGGATGCggccgc
Amino Acid Sequence:
View Sequence

Antibiotic:
Kan
Comments:
CRISPR donor plasmid. Designed to KI an HA tag to the N-terminus of RAB1A when co-transfected with guides 48937 and 48951. Donor sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line, contains several silent mutations to prevent binding of guides.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.