cDNA Clone - RAB1B

Name: RAB1B
Price per aliquot: £110.00
Expressed:
RAB1B Nter KI antisense guide + Cas9 D10A
Plasmid:
pX335 RAB1B Nter KI antisense
Parent Plasmid:
pX335
View Parent Plasmid

|
DU Number:
DU48952
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GGCGGGGCTCACTCACTATT
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR guide plasmid. Targets antisense of exon 1, designed to KI an HA tag to the N-terminus of RAB1B when co-transfected with sense guide 48938 and donor 48991. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.