cDNA Clone - RAB8B

Name: RAB8B
Price per aliquot: £110.00
Expressed:
RAB8B Nter KI sense guide
Plasmid:
pBABED P U6 RAB8B Nter KI sense
Parent Plasmid:
pBABED P U6
View Parent Plasmid

Snapgene File | Genbank File
GTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGGCCGCAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAACTATGGCCATTTAATGTAAATACTTAAGAAAAAAAACCAAATTAATTTTGATACATGCTGCATGTGAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGCAGCGAGACCACAAGTCGGAAATGAAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGAACAGCGAGACCACAAGTCGGATGCAACTGCAAGAGGGTTTATTGGATACACGGGTACCCGGGCGACTCAGTCAATCGGAGGACTGGCGCCCCGAGTGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCATTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACTGCTGAGGGCTGGACCGCATCTGGGGACCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCCTGACCTTGATCTGAACTTCTCTATTCTCAGTTATGTATTTTTCCATGCCTTGCAAAATGGCGTTACTTAAGCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATTCCCCCCTTTTTCTGGAGACTAAATAAAATCTTTTATTTTATCGATGCATGGGGTCGTGCGCTCCTTTCGGTCGGGCGCTGCGGGTCGTGGGGCGGGCGTCAGGCACCGGGCTTGCGGGTCATGCACCAGGTGCGCGGTCCTTCGGGCACCTCGACGTCGGCGGTGACGGTGAAGCCGAGCCGCTCGTAGAAGGGGAGGTTGCGGGGCGCGGAGGTCTCCAGGAAGGCGGGCACCCCGGCGCGCTCGGCCGCCTCCACTCCGGGGAGCACGACGGCGCTGCCCAGACCCTTGCCCTGGTGGTCGGGCGAGACGCCGACGGTGGCCAGGAACCACGCGGGCTCCTTGGGCCGGTGCGGCGCCAGGAGGCCTTCCATCTGTTGCTGCGCGGCCAGCCGGGAACCGCTCAACTCGGCCATGCGCGGGCCGATCTCGGCGAACACCGCCCCCGCTTCGACGCTCTCCGGCGTGGTCCAGACCGCCACCGCGGCGCCGTCGTCCGCGACCCACACCTTGCCGATGTCGAGCCCGACGCGCGTGAGGAAGAGTTCTTGCAGCTCGGTGACCCGCTCGATGTGGCGGTCCGGATCGACGGTGTGGCGCGTGGCGGGGTAGTCGGCGAACGCGGCGGCGAGGGTGCGTACGGCCCTGGGGACGTCGTCGCGGGTGGCGAGGCGCACCGTGGGCTTGTACTCGGTCATGGTAAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGGagatcttacgcggccgcaccggttgcGTCGACGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAATTCAGATCCGGCCGGCGCCTAGAGAAGGAGTGAGGGCTGGATAAAGGGAGGATCGAGGCGGGGTCGAACGAGGAGGTTCAAGGGGGAGAGACGGGGCGGATGGAGGAAGAGGAGGCGGAGGCTTAGGGTGTACAAAGGGCTTGACCCAGGGAGGGGGGTCAAAAGCCAAGGCTTCCCAGGTCACGATGTAGGGGACCTGGTCTGGGTGTCCATGCGGGCCAGGTGAAAAGACCTTGATCTTAACCTGGGTGATGAGGTCTCGGTTAAAGGTGCCGTCTCGCGGCCATCCGACGTTAAAGGTTGGCCATTCTGCAGAGCAGAAGGTAACCCAACGTCTCTTCTTGACATCTACCGACTGGTTGTGAGCGATCCGCTCGACATCTTTCCAGTGACCTAAGGTCAAACTTAAGGGAGTGGTAACAGTCTGGCCCTAATTTTCAGACAAATACAGAAACACAGTCAGACAGAGACAACACAGAACGATGCTGCAGCGCTGCAGCAGACAAGACGCGCGGCTTCGGTTCCAAACCGAAAGCAAAAATTCAGACGGAGGCGGGAACTGTTTTAGGTTCTCGTCTCCTACCAGAACCACATATCCTGACGGGGTCGGATTCCACATCGACTCCCTTCCTCAGGTCGGGCCACAAAAACGGCCCCCAAAGTCCCTGGGACGTCTCCCAGGGTTGCGGCCGGGTGTTCAGAACTCGTCAGTTCCACCACGGGTCCGCCAGATACAGAGCTAGTTAGCTAACTAGTACCGACGCAGGCGCATAAAATCAGTCATAGACACTAGACAATCGGACAGACACAGATAAGTTGCTGGCCAGCTTGCCTCCCGGTGGTGGGTCGGTGGTCCCTGGGCAGGGGTCTCCCGATCCCGGACGAGCCCCCAAATGAAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGAACAGCGAGACCACAAGTCGGATGCAACTGCAAGAGGGTTTATTGGATACACGGGTACCCGGGCGACTCAGTCAATCGGAGGACTGGCGCCCCGAGTGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCATTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACTGCTGAGGGCTGGACCGCATCTGGGGACCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGGCTGCAG
DU Number:
DU48935
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GCTCCTGCTGATCGGCGACT
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR guide plasmid. Targets sense strand of exon 1, designed to KI an HA to tag to the N-terminus of RAB8B when co-transfected with antisense guide 48949 and donor 48994. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.