cDNA Clone - FBX7

Name: FBX7
Price per aliquot: £125.00
Plasmid:
pSc-B-Fbx07
View Parent Plasmid

DU Number:
DU24788
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GAATTCATGAGGCTGCGGGTGCGGCTTCTGAAGCGGACCTGGCCGCTGGAGGTGCCCGAGACGGAGCCGACGCTGGGGCATTTGCGCTCGCACCTGAGGCAGTCCCTGCTGTGCACCTGGGGGTACAGTTCTAATACCCGATTTACAATTACATTGAACTACAAGGATCCCCTCACTGGAGATGAAGAGACCTTGGCTTCATATGGGATTGTTTCTGGGGACTTGATATGTTTGATTCTTCAAGATGACATTCCAGCGCCTAATATACCTTCATCCACAGATTCAGAGCATTCTTCACTCCAGAATAATGAGCAACCCTCTTTGGCCACCAGCTCCAATCAGACTAGCATGCAGGATGAACAACCAAGTGATTCATTCCAAGGACAGGCAGCCCAGTCTGGTGTTTGGAATGACGACAGTATGTTAGGGCCTAGTCAAAATTTTGAAGCTGAGTCAATTCAAGATAATGCGCATATGGCAGAGGGCACAGGTTTCTATCCCTCAGAACCCATGCTCTGTAGTGAATCGGTGGAAGGGCAAGTGCCACATTCATTAGAGACCTTGTATCAATCAGCTGACTGTTCTGATGCCAATGATGCCTTGATAGTGTTGATACATCTTCTCATGTTGGAGTCAGGTTACATACCTCAGGGCACCGAAGCCAAAGCACTGTCCATGCCGGAGAAGTGGAAGTTGAGCGGGGTGTATAAGCTGCAGTACATGCATCCTCTCTGCGAGGGCAGCTCCGCTACTCTCACCTGTGTGCCTTTGGGAAACCTGATTGTTGTAAATGCTACACTAAAAATCAACAATGAGATTAGAAGTGTGAAAAGATTGCAGCTGCTACCAGAATCTTTTATTTGCAAAGAGAAACTAGGGGAAAATGTAGCCAACATATACAAAGATCTTCAGAAACTCTCTCGCCTCTTTAAAGACCAGCTGGTGTATCCTCTTCTGGCTTTTACCCGACAAGCACTGAACCTACCAGATGTATTTGGGTTGGTCGTCCTCCCATTGGAACTGAAACTACGGATCTTCCGACTTCTGGATGTTCGTTCCGTCTTGTCTTTGTCTGCGGTTTGTCGTGACCTCTTTACTGCTTCAAATGACCCACTCCTGTGGAGGTTTTTATATCTGCGTGATTTTCGAGACAATACTGTCAGAGTTCAAGACACAGATTGGAAAGAACTGTACAGGAAGAGGCACATACAAAGAAAAGAATCCCCGAAAGGGCGGTTTGTGATGCTCCTGCCATCGTCAACTCACACCATTCCATTCTATCCCAACCCCTTGCACCCTAGGCCATTTCCTAGCTCCCGCCTTCCTCCAGGAATTATCGGGGGTGAATATGACCAAAGACCAACACTTCCCTATGTTGGAGACCCAATCAGTTCACTCATTCCTGGTCCTGGGGAGACGCCCAGCCAGTTTCCTCCACTGAGACCACGCTTTGATCCAGTTGGCCCACTTCCAGGACCTAACCCCATCTTGCCAGGGCGAGGCGGCCCCAATGACAGATTTCCCTTTAGACCCAGCAGGGGTCGGCCAACTGATGGCCGGCTGTCATTCATGTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

Bacterial Selection:
Amp, Kan

Do you need any help? Please get in touch and we’ll be happy to lend a hand.