cDNA Clone - Rab8b

Name: Rab8b
Price per aliquot: £110.00
pGEX6P-1 rab8b
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
Sequence of Insert:
View Sequence

GGATCCatggcgaagacgtacgattatctcttcaagctcctgctgatcgg cgactcgggggtaggcaagacctgcctcctgttccgcttctcagaggacg ccttcaacaccaccttcatctccaccatcggaattgattttaaaattaga acgatagaactagatggaaagaaaattaagcttcagatatgggacacagc gggtcaggaaagattccgaacaatcacgacagcgtactacagaggagcca tgggcattatgctggtctatgacatcacaaatgaaaaatcctttgacaat attaaaaattggatcagaaacattgaagagcatgcctcttccgatgtcga aagaatgatcctgggtaacaaatgtgatatgaatgacaaaagacaagtgt caaaagaaagaggggagaagctagcaattgactatgggattaaattcttg gagacaagcgcaaaatccagtgcaaatgtagaagaggcattttttacact tgcacgagatataatgacaaaactcaacagaaaaatgaatgacagcaatt cagcaggagcaggtggaccagtgaaaataacagaaaaccgatcaaagaag accagtttctttcgttgctcgctactttgaGCGGCCGC
Amino Acid Sequence:
View Sequence


Do you need any help? Please get in touch and we’ll be happy to lend a hand.