Plasmid
pSuperior Retro Puro Non Targetting ShRNA
Parent Plasmid
pSuperior retro puro
Expressed
Non-targeting shRNA
Sequence of Insert
View Sequence
AGATCTCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTAAGCTT
Vector Type
Mammalian
Antibiotic
Amp
DU Number
DU25077
Unit Source
Location
PPU
MTA
Price
£125.00
To submit an order for this reagent acceptance of the Dundee Material Transfer Agreement is required at checkout.

