Synonyms
PIA, mAVO3
Plasmid
pLKO1.Neo RICTOR siRNA.2
Parent Plasmid
pLKO.1 neo
Expressed
RICTOR siRNA.2 hairpin
Genbank
NM_152756.3
Species
Human
Vector Type
Mammalian
Antibiotic
Amp
DU Number
DU44845
Unit Source
Location
PPU
MTA
Notes
Target sequence: ACTTGTGAAGAATCGTATCTT
Price
£125.00
To submit an order for this reagent acceptance of the Dundee Material Transfer Agreement is required at checkout.

