cDNA Clone Ufl1/DDRGK1

• Synonyms: cHMM113
• Plasmid: pETDuet1 6His TEV Ufl1 1-116/StrepII DDRGK1 29-C
• Parent Plasmid: pETDuet1
• Expressed: 6His TEV Ufl1 1-116/StrepII DDRGK1 29-C
• Genbank: NM_015323.4
• Tag: 6His
• Species: Human

Sequence of Insert

See snapgene map

Amino Acid Sequence

See snapgene map

• Vector Type: Bacterial
• Antibiotic: Amp
• Full Snapgene Map: pETDuet1 6His TEV Ufl1 1-116/StrepII DDRGK1 29-C2.14 MB Snapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU73843
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Mutagenesis of DU63479 using oligos GGGACAACTGATAGATTAGAATTATTTGGATCGG and CCGATCCAAATAATTCTAATCTATCAGTTGTCCC to truncate Ufl1 after residue 116. Made and deposited by Helge Magnussen (MRCPPU Kulathu group).
• Low Temp: No