cDNA Clone USP35

• Plasmid: pU6 USP35 Nter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: USP35 Nter gRNA
• Genbank: NM_020798.2
• Species: Human

Sequence of Insert

GGACAAGATCTTGGAGGCGG(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48242
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses USP35 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets first coding exon (exon 2).