cDNA Clone RNF31

• Synonyms: HOIP, ZIBRA
• Plasmid: pX335 RNF31 KO antisense
• Parent Plasmid: pX335
• Expressed: RNF31 KO antisense guide + Cas9 D10A
• Genbank: NM_017999.4
• Species: Human

Sequence of Insert

GAGCAATCTCTCTCAATAGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52115
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52105.