cDNA Clone RNF31

• Synonyms: HOIP, ZIBRA
• Plasmid: pBABED P U6 RNF31 C885S KI sense
• Parent Plasmid: pBABED P U6
• Expressed: RNF31 C885S KI sense guide
• Genbank: ENSG00000092098
• Species: Human

Sequence of Insert

GAAAGTGCATGCAGCCTCCTC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54122
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide designed to introduce a C885S point mutation, use in conjunction with 54126 and a suitable donor.