cDNA Clone TAB3

• Synonyms: MAP3K7IP3, NAP1
• Plasmid: pU6 TAB3 Nter gRNA
• Parent Plasmid: pU6 gRNA
• Expressed: TAB3 Nter gRNA
• Genbank: ENSG00000157625
• Species: Human

Sequence of Insert

GGAAACGTTGTCGAAGATCA(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48131
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TAB3 N-terminal guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets close to the ATG start of the coding region in exon 2. PAM site is situated on the reverse strand.