cDNA Clone SGK1

• Synonyms: SGK
• Plasmid: pBABED P U6 SGK1 Nter gRNA
• Parent Plasmid: pBabeD puro
• Expressed: SGK1 Nter gRNA
• Genbank: ENSG00000118515
• Species: Human

Sequence of Insert

GCTTTCATGAAGCAGAGGAGGA(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48213
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SGK1 guide RNA, 22mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets first common coding exon (exon 4).