cDNA Clone WNK1

• Synonyms: HSAN2, HSN2, KDP, PRKWNK1, PSK, p65
• Plasmid: pU6 WNK1 Nter KO gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: WNK1 Nter KO gRNA
• Genbank: NM_018979.3
• Species: Human

Sequence of Insert

gcaggatgatatcgaagagc(tgg)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48404
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses WNK1 N-terminal guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets the first coding exon 1, PAM site situated on sense strand. Designed to KO WNK1 by introducing an Indel via CRISPR. To be screened for by PCR and EcoRV digestion, loss of the site shall indicate a deletion event and potential frameshift.