cDNA Clone WNK3

• Synonyms: PRKWNK3
• Plasmid: pX335 WNK3 ex2 KO as
• Parent Plasmid: pX335
• Expressed: WNK3 ex2 KO antisense guide
• Genbank: NM_020922.4
• Species: Human

Sequence of Insert

GAATTTCAGGAATCTGCCACT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48799
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Expresses WNK3 N-terminal guide RNA, 20mer target sequence shown as sequence of insert. Targets close to the ATG start codon in exon 2, PAM site situated on antisense strand. Designed to either introduce a GFP reporter (donor 48425) to WNK3 or if used in conjunction with DU48773 may KO by introducing an indel. Positives may be enriched for with puromycin selection and further screened by FACs for GFP expression (KI) or for KOs look for knockdown in pools or use RFLP to look for a deleted BamHI site.