cDNA Clone TAB1

• Synonyms: 3'-Tab1, MAP3K7IP1
• Plasmid: pU6 TAB1 KO gRNA C
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: TAB1 KO gRNA C
• Genbank: NG_029549.1
• Species: Human

Sequence of Insert

GCTGTCCGCAGAGCTCCTGC(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48412
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses TAB1 N-terminal KO guide RNA C, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets exon 3, PAM site situated on sense strand. Designed to KO TAB1 by introducing an Indel via CRISPR. To be screened for by PCR and SacI digestion, loss of the site shall indicate a deletion event and potential frameshift.