cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D SGK3 Nter NcoI KO guide B
• Parent Plasmid: pU6D gRNA
• Expressed: Nter NcoI KO guide B
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GCAGCTTTCCTTGTAGTCCA(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48559
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SGK3 Nter KI sense guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets just downstream of the start codon, PAM site situated on antisense strand. Designed to KI an in-frame GFP via CRISPR (wild-type Cas9) when used in conjunction with the antisense guide DU48554 and the GFP donor DU48167. To be screened for by GFP analysis and verified by PCR and western. May also be used in the absence of a donor and the KO screened for by RFLP-NcoI digestion.