cDNA Clone USP35

• Plasmid: pU6D USP35 Nter KI guide 2
• Parent Plasmid: pU6D gRNA
• Expressed: USP35 Nter KI guide 2
• Genbank: NM_020798.2
• Species: Human

Sequence of Insert

GGTGGTGACGTCGTCATACC(CGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48564
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses USP35 Nter KI guide 2, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets the sense strand near the start codon of exon 2, designed to knock-in an in-frame GFP tag to the N-terminus of USP35. To be co-transfected along with guide RNA DU48242 and the GFP donor DU48? into a cell-line expressing wild-type Cas9. This guide may also be used to KO by indel formation, screen for by RFLP-AatII/ZraI site loss.