cDNA Clone SLC12A2

• Synonyms: BSC, BSC2, NKCC1, PPP1R141
• Plasmid: pU6D SLC12A2 SmaI KO Guide A
• Parent Plasmid: pU6D gRNA
• Expressed: SLC12A2 SmaI KO Guide A
• Genbank: ENSG00000064651
• Species: Human

Sequence of Insert

GGCCAGTCCCGGGGCGCCGG(AGG)

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48609
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first common coding exon (exon 1) of SLC12A2, indel formation may lead to the deletion of a SmaI site allowing RFLP screening. Guide sequence shown as sequence of insert with PAM in brackets.