cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D shuttle SGK3 Cter KI sense
• Parent Plasmid: pU6D shuttle
• Expressed: SGK3 Cter KI sense
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGGCAGATGATGCATTCGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48734
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets near stop in last coding exon, may be used in conjunction with sense guide 48713 and donor 48203 Cas9 D10A to knock-in an in-frame GFP to the c-terminus. The insert may be excised and shuttled to destination lentiviral vectors as necessary.