cDNA Clone WNK2

• Synonyms: NY-CO-43, P/OKcl.13, PRKWNK2, SDCCAG43
• Plasmid: pBABED P WNK2 KO ex1 sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK2 KO ex1 sense
• Genbank: NP_005100
• Species: Human

Sequence of Insert

GCAAGACGCGCCGCCTCATCG

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48772
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first common coding exon (exon 1), designed to KO WNK2 when used in conjunction with antisense guide 48771 (D10A approach). Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection using western blotting.