cDNA Clone WNK3

• Synonyms: PRKWNK3
• Plasmid: pX335 WNK3 D294A antisense.1
• Parent Plasmid: pX335
• Expressed: WNK3 D294A antisense.1 guide
• Genbank: NM_020922.4
• Species: Human

Sequence of Insert

GACCAATCTTCACAGATCCAG

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48785
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets exon 4, designed to introduce a D294A point mutation when used in conjunction with sense guide 48791 and a ssODN donor (D10A approach). Guide sequence shown as sequence of insert and donor as expression cassette. Positives may be enriched for with puromycin prior to further selection using western blotting with a phospho specific antibody or RFLP using the SfoI site introduced upon recombination.