cDNA Clone RAB1B

• Plasmid: pX335 RAB1B Nter KI antisense
• Parent Plasmid: pX335
• Expressed: RAB1B Nter KI antisense guide + Cas9 D10A
• Genbank: NM_030981.2
• Species: Human

Sequence of Insert

GGCGGGGCTCACTCACTATT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48952
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense of exon 1, designed to KI an HA tag to the N-terminus of RAB1B when co-transfected with sense guide 48938 and donor 48991. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.