cDNA Clone SGK1

• Synonyms: SGK
• Plasmid: pBABED P U6 SGK1 KO antisense B
• Parent Plasmid: pBABED P U6
• Expressed: SGK1 KO antisense guide B
• Genbank: ENSG00000118515
• Species: Human

Sequence of Insert

GTTAGACGGCTTCATAACGTC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48998
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Designed to KO SGK1 when co-transfected with sense guide 48987. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.