cDNA Clone USP27X

• Synonyms: USP22L, USP27
• Plasmid: pX335 USP27X KO antisense
• Parent Plasmid: pX335
• Expressed: USP27X KO antisense guide + Cas9 D10A
• Genbank: NP_001138545.1
• Species: Human

Sequence of Insert

GAGAAACCTCTGTTGAGGTGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52015
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 48999