cDNA Clone TRIM65

• Plasmid: pX335 TRIM65 KO antisense
• Parent Plasmid: pX335
• Expressed: TRIM65 KO antisense guide + Cas9 D10A
• Genbank: NM_173547.2
• Species: Human

Sequence of Insert

GAGCTCGGCGCCGTCGGGAAA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52089
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52078