cDNA Clone OSR1 (mouse)

• Synonyms: Odd1, Osr, OXSR1
• Plasmid: pBABED P U6 OSR1m Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: OSR1m Nter KI sense guide
• Genbank: NM_011859.3
• Species: Mouse

Sequence of Insert

CAGCAAAACCTTGCCAGCAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52187
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52195 and suitable donor e.g. 52331.