cDNA Clone SLC12A2

• Synonyms: BSC, BSC2, NKCC1, PPP1R141
• Plasmid: pX335 SLC12A2 KO antisense
• Parent Plasmid: pX335
• Expressed: SLC12A2 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000064651
• Species: Human

Sequence of Insert

AGTCCCGGGGCGCCGGAGGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52200
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52192.