cDNA Clone RAB8A

• Synonyms: MEL, RAB8
• Plasmid: pBABED P U6 RAB8A Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: RAB8A Nter KI sense guide
• Genbank: ENSG00000167461
• Species: Human

Sequence of Insert

GTGTTCAAGCTGCTGCTGATC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52654
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52679 and a suitable donor.