cDNA Clone RAB8B

• Plasmid: pX335 RAB8B ex1 KO antisense C
• Parent Plasmid: pX335
• Expressed: RAB8B ex1 KO antisense guide C + Cas9dn
• Genbank: ENSG00000166128
• Species: Human

Sequence of Insert

GCCCCCGAGTCGCCGATCAGC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52777
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 1, use in conjunction with 52763.