cDNA Clone RFWD3 (mouse)

• Synonyms: BC027246
• Plasmid: pX335 mRFWD3 ex11 V639K KI antisense
• Parent Plasmid: pX335
• Expressed: mRFWD3 ex11 V639K KI antisense guide + Cas9n
• Genbank: ENSMUSG00000033596
• Species: Mouse

Sequence of Insert

GTGTCTTGTGACTTACAGACC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54005
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide targeting exon 11, use in conjunction with 52997 and 54133.