cDNA Clone RAB43

• Synonyms: RAB11B, RAB41
• Plasmid: pBABED P U6 RAB43 ex2 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: RAB43 ex2 KO sense guide
• Genbank: ENSG00000172780
• Species: Human

Sequence of Insert

GCCACCAGCACCAGCTTGAAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54345
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 2, use in conjunction with 54351.